A new mouse model to study restoration of interleukin-6 (IL-6) expression in a Cre-dependent manner: microglial IL-6 regulation of experimental autoimmune encephalomyelitis | Journal of Neuroinflammation | Full Text
Particulate matter induces inflammatory cytokine production via activation of NFκB by TLR5-NOX4-ROS signaling in human skin keratinocyte and mouse skin - ScienceDirect
Identification of IL-6 mRNA isoforms in rat and human. (A) RT-PCR... | Download Scientific Diagram
Primers used for TNF-a, IL-1b, IL-6 and GAPDH. | Download Table
Frontiers | IL-10/STAT3/SOCS3 Axis Is Involved in the Anti-inflammatory Effect of Benznidazole
Frontiers | Production of IL-6 and Phagocytosis Are the Most Resilient Immune Functions in Metabolically Compromised Human Monocytes
xmlinkhub
Chromatin remodelling and autocrine TNFα are required for optimal interleukin-6 expression in activated human neutrophils | Nature Communications
Table 1 from PROVO, JAMES NATHAN, M.S. Impact of Trans-10, cis-12 Conjugated Linoleic Acid on Interleukin (IL)-6 and IL-8 and Adipogenic Genes in Cultures of Human Adipose | Semantic Scholar
xmlinkhub
Specific primers for IL-6 regions | Download Scientific Diagram
Dihydrocapsaicin Attenuates Plaque Formation through a PPARγ/LXRα Pathway in apoE−/− Mice Fed a High-Fat/High-Cholesterol Diet | PLOS ONE
Primer and probe sequences. | Download Table
Biomedicines | Free Full-Text | Cytokine (IL-10, IL-6, TNF-α and TGF-β1) Gene Polymorphisms in Chronic Hepatitis C Virus Infection among Malay Male Drug Abusers
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Primers and probes of proinflammatory cytokines (TNF-α, IL-1β, and... | Download Table
Frontiers | Increased Expression of Interleukin-6 Family Members and Receptors in Urinary Bladder with Cyclophosphamide-Induced Bladder Inflammation in Female Rats
Enhanced IL-6/IL-6R Signaling Promotes Growth and Malignant Properties in EBV-Infected Premalignant and Cancerous Nasopharyngeal Epithelial Cells | PLOS ONE
Interleukin-6-stimulated progranulin expression contributes to the malignancy of hepatocellular carcinoma cells by activating mTOR signaling | Scientific Reports
TNF-α and IL-6 signals from the bone marrow derived cells are necessary for normal murine liver regeneration - ScienceDirect
Primer sequences for PCR amplification of the chicken IL-6 gene. | Download Scientific Diagram
PCR primer description and sequences | Download Table
